Worksheet
Groups
Split into your group and translate a DNA sequence to a protein, and investigate the origin of the DNA sequence.
Group 1 DNA sequence
ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTG
Group 2 DNA sequence
ATGAACGCCCCTCTCGGTGGAATCTGGCTCTGG
Group 3 DNA sequence
ATGGCACACGCTATGGAAAACTCCTGGACAATC
Part I
Your task is to translate the DNA sequence into a protein sequence.
DNA to RNA
Convert the DNA to RNA
Note
Recall in RNA that thyime (T) is substituted for uracil (U).
RNA to Protein
Once you have correctly converted the sequence to RNA, translate it into a protein sequence.
Use the following table as a guide to converting your RNA sequence into a protein sequence.
Note
Recall that a triplet of RNA is translated to one amino acid. The first triplet AUG becomes Methionine (M).
Part II
What organisms is this gene present in?
Copy the DNA sequence and go to NCBI BLAST.
Paste the DNA sequence into the box under
Enter Query Sequenceand clickBLAST.When your results load, pay attention to the
Scientific Namecolumn. What species does the sequence belong to? For some groups you will get multiple species - select a few.
Note
Scientific names are given in Latin - google the scientific names to see what the species is in english!
Part III
What gene does the sequence belong to?
In your
BLASTresults, the gene name is given in theDescriptioncolumn in parentheses().
Google the gene name, what does this gene do? Provide a few sentences on the genes function.
Part IV
Go to the IGV browser (https://igv.org/app/).
In the search bar, enter the name of the gene our sequence belongs to.
What chromosome is the gene located on?
Is the gene located on the forward or reverse strand? (see below)
Recall that DNA is a double stranded molecule, containing both a forward strand and a reverse strand:
5' A G T G C T A G G G T 3' (forward strand)
| | | | | | | | | | |
3' T G C T G A T C C C A 5' (reverse strand)
Zoom in on the gene, you will be able to see ‘less than / greater than’ symbols (> and <) which denote if the gene is on the forward or reverse strand, respectively.