Worksheet

Groups

Split into your group and translate a DNA sequence to a protein, and investigate the origin of the DNA sequence.

../_images/YA_groups.png

Group 1 DNA sequence

ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTG

Group 2 DNA sequence

ATGAACGCCCCTCTCGGTGGAATCTGGCTCTGG

Group 3 DNA sequence

ATGGCACACGCTATGGAAAACTCCTGGACAATC

Part I

Your task is to translate the DNA sequence into a protein sequence.

DNA to RNA

Convert the DNA to RNA

Note

Recall in RNA that thyime (T) is substituted for uracil (U).

RNA to Protein

Once you have correctly converted the sequence to RNA, translate it into a protein sequence.

Use the following table as a guide to converting your RNA sequence into a protein sequence.

../_images/translation_table.png

Note

Recall that a triplet of RNA is translated to one amino acid. The first triplet AUG becomes Methionine (M).

Part II

What organisms is this gene present in?

  • Copy the DNA sequence and go to NCBI BLAST.

  • Paste the DNA sequence into the box under Enter Query Sequence and click BLAST.

  • When your results load, pay attention to the Scientific Name column. What species does the sequence belong to? For some groups you will get multiple species - select a few.

Note

Scientific names are given in Latin - google the scientific names to see what the species is in english!

Part III

What gene does the sequence belong to?

  • In your BLAST results, the gene name is given in the Description column in parentheses ().

Google the gene name, what does this gene do? Provide a few sentences on the genes function.

Part IV

  • Go to the IGV browser (https://igv.org/app/).

  • In the search bar, enter the name of the gene our sequence belongs to.

  1. What chromosome is the gene located on?

  2. Is the gene located on the forward or reverse strand? (see below)


Recall that DNA is a double stranded molecule, containing both a forward strand and a reverse strand:

5' A G T G C T A G G G T 3' (forward strand)
   | | | | | | | | | | |
3' T G C T G A T C C C A 5' (reverse strand)

Zoom in on the gene, you will be able to see ‘less than / greater than’ symbols (> and <) which denote if the gene is on the forward or reverse strand, respectively.